. .
.
Guanine-Cytosine Content Analysis and Basics of DNA Sequence Statistics
.
.

 

 

Tasks to be performed

 

  1. Given two plant species Gossypium thurberi and Zea mays L. Find out which species have high guanine cytosine content.
  2. Given two FASTA sequence

            


GGAGGCTCCTCCCTGGGCTATGGGGGTCTGTATGGCTATGGAGGCTCCTCCCTGGGCTATGGGGGTCTGT
ATGGCCTTGGGAGCTATGGGGGCTATGGGGGTCTGTATGGGGGCTCCCCTGGGTACAGGGGTCTGTATGG
CTATGGTAGATCCTATGGCTCTGGCTATTGCAGCCCTTACCGGTACAACAGGTTCCGCCGTGGCAGCTGT
GGGCCCTGCTAAATTAAAGCAATTTTCTTCTG


GGAGGCTCCTCCCTGGGCTACGGGGGCCTGTATGGCTATGGAGGCTCCTCCCTGGGCTACGGGGGCCTGT
ATGGCTATGGAGGCTCCTCCCTGGGCTACGGGGGCCTGTATGGCTATGGTAGATCCTATGGTTCCGGCTA
CTGCAGCCCTTACTCCTACCGGTACAACAGGTACCGCCGTGGCAGCTGCGGGCCCTGCTAAATTAAAAGT
TTATTGCATC

Find which sequence have high melting point?

 

   3.  Find the GC content of insulin, keratin and albumin in humans.

 

 

 

 

 

 

 

 

 

Cite this Simulator:

.....
..... .....

Copyright @ 2022 Under the NME ICT initiative of MHRD

 Powered by AmritaVirtual Lab Collaborative Platform [ Ver 00.13. ]