DNA Sequence Analysis and Determining DNA Open Reading Frames (Assignment) : Bioinformatics and Data Science in Biotechnology : Biotechnology and Biomedical Engineering : Amrita Vishwa Vidyapeetham Virtual Lab

.

you are here->home->Biotechnology and Biomedical Engineering->Bioinformatics and Data Science in Biotechnology->DNA Sequence Analysis and Determining DNA Open Reading Frames

.

.

DNA Sequence Analysis and Determining DNA Open Reading Frames

.

.

	Theory Procedure PreTest Simulator PostTest Assignment Reference Feedback

Tasks to be performed

Using the simulator window find the ORF for the given DNA sequence.

5'ATGCAATGGGGAAATGTTACCAGGTCCGAACTTATTGAGGTAAGACAGATTTAA3'

5'ATGCAATGGGGAAATGTTACCAGGTCCGAACTTATTGAGGTAAGACAGATTTAA3'

5'ATGCAATGGGGAAATGTTACCAGGTCCGAACTTATTGAGGTAAGACAGATTTAA3'

Cite this Simulator:

.....

.....

.....

Copyright @ 2025 Under the NME ICT initiative of MHRD

Powered by Amrita Virtual Lab Collaborative Platform [ Ver 00.13. ]