. .
.
DNA Sequence Analysis and Determining DNA Open Reading Frames
.
.

 

 

Tasks to be performed

 

  1. Using the simulator window find the ORF for the given DNA sequence.

                       5'ATGCAATGGGGAAATGTTACCAGGTCCGAACTTATTGAGGTAAGACAGATTTAA3'

                       5'ATGCAATGGGGAAATGTTACCAGGTCCGAACTTATTGAGGTAAGACAGATTTAA3'

                       5'ATGCAATGGGGAAATGTTACCAGGTCCGAACTTATTGAGGTAAGACAGATTTAA3'

 

 

 

 

Cite this Simulator:

.....
..... .....

Copyright @ 2022 Under the NME ICT initiative of MHRD

 Powered by AmritaVirtual Lab Collaborative Platform [ Ver 00.13. ]