. .
.
Guanine-Cytosine Content Analysis and Basics of DNA Sequence Statistics
.
.

 

Procedure

 

  1. Follow ( https://vlab.amrita.edu/index.php?sub=3&brch=311&sim=1835&cnt=2) to install R in personal computer.
  2. Install sequinR package. Follow the code  

                     install.packages('seqinr')

                       library('seqinr')

 

Procedure to calculate GC content in a personal computer

 

  1. Follow the code in the command window:

                 library("seqinr")
                seq1<-s2c("atgcttaaagctagctagggcatggcatggctaggctatggagactgactacg")
                GC(seq1)

        2. Click execute button for output.

 

Description

 

The experiment uses “seqinr” library for finding Guanine-Cytosine (GC) content in R programing. GC content is the ratio of Guanine-Cytosine in a nucleotide sequence. First line of code is importing the seqinr library into the workspace. The function “s2c” convert the string into an array and assign to a variable named seq1 and the GC( ) function in seqinr library calculates the GC content of the given nucleotide sequence.

 

Procedure to work simulator

 

  1. Paste any DNA sequence in the textbox provided. Click on “ Find GC” button

  2. GC ratio will be displayed in the GUI.

 

 

 

 

 

Cite this Simulator:

.....
..... .....

Copyright @ 2024 Under the NME ICT initiative of MHRD

 Powered by AmritaVirtual Lab Collaborative Platform [ Ver 00.13. ]