Gene finding: Finding Start and Stop codons using R (Assignment) : Bioinformatics and Data Science in Biotechnology : Biotechnology and Biomedical Engineering : Amrita Vishwa Vidyapeetham Virtual Lab

Gene finding: Finding Start and Stop codons using R

	Theory Procedure PreTest Simulator PostTest Assignment Reference Feedback

Using the simulator find find answers for the following

Find the number of start and stop codons using the given nucleotide sequence “aaaatgcagtaacccatgccc”.
Retrieve any nucleotide sequence from NCBI database and find the number of start and stop codons in that sequence using R programming.

Cite this Simulator:

.....