. .
.
Gene finding: Finding Start and Stop codons using R
.
.

 

 

Tasks to be performed

 

Using the simulator find find answers for the following

 

  1. Find the number of start and stop codons using the given nucleotide sequence “aaaatgcagtaacccatgccc”. 
  2. Retrieve any nucleotide sequence from NCBI database and find the number of start and stop codons in that sequence using R programming.

 

 

 

 


 

Cite this Simulator:

.....
..... .....

Copyright @ 2025 Under the NME ICT initiative of MHRD

 Powered by AmritaVirtual Lab Collaborative Platform [ Ver 00.13. ]