. .
.
DNA Sequence Analysis and Determining DNA Open Reading Frames
.
.

 

 

Procedure

 

Import “stringr” library to R workspace
Create function for finding Start and Stop codon
Function1
    Create an array with start and stop codons
        for each elements in the array
            match the occurrences of start and stop codons
            find the starting position of each codons
            find the total number of potential start and stop codons
        end
    sort the sequences vectors
    return
end of function1

Function2
    Import Biostrings package to R workspace
    Create a vector to store positions information of sequence
    Call fuction1() and pass the nucleotide sequence
    Create vector to store ORF start positions of input sequence
    Create vector to store ORF stop positions of input sequence
    Create vector to store ORF sequence length
    If number of start and stop codon position is >= 2
Assign the values to the vectors
Find the length of the sequence from start to stop
Check the stop codon is already used in an ORF position
    End if
    Sort the final ORFs by start position
    Find the length of ORFs recorded
    Return the list
end of fuction2
Call fucntion2() with the nucleotide sequence input.
 

 

Procedure to work simulator

 

  • Provide a DNA sequence in user interface for finding ORF. For example provide a hypothetical sequence 

             CGCTACGTCTTACGCTGGAGCTCTCATGGATCGGTTCGGTAGGGCTCGATCACATCGCTAGCCAT

                 

 

  • Click on Find ORF tab for executing simulator.

  • A default sequence file is provided in the user interface. User can download the file and can use the file as query sequence for finding ORF.

ORF is a continuous stretch of codons with a start codon usually AUG and with a stop codons usually UAA, UAG or UGA.

 

 

 

 

 

 

 

 

Cite this Simulator:

.....
..... .....

Copyright @ 2026 Under the NME ICT initiative of MHRD

 Powered by AmritaVirtual Lab Collaborative Platform [ Ver 00.13. ]